First report of White clover mosaic virus on white clover (Trifolium repens) in Korea

White clover mosaic virus (WClMV), genus Potexvirus (Nakabayashi et al. 2002), has been designated as a quarantine virus in Korea. In 2013 and 2015, three white clover leaf samples were collected near two crop fields (soybean [Glycine max] and peach [Prunus persica]) in two regions (one in Suwon, two in Cheongdo) in Gyeonggi-do and Gyeongsangbuk-do provinces. Three samples exhibited yellowing mosaic and mottle. Crude sap was extracted from three leaves of each sample using potassium phosphate buffer (pH 7.0) and subjected to the direct negative staining method to observe viral particles. Filamentous virions ∼500 nm in length were observed using transmission electron microscopy. To determine the identity of virus particles observed in samples, total RNA was extracted using Trireagent (MRC Reagent, U.S.A.) per manufacturer’s protocol and analyzed using the large-scale oligonucleotide (LSON) chip (Nam et al. 2014). This yielded a positive signal with WClMV in the sample collected from Suwon and with Clover yellow vein virus (ClYVV) and WClMV in the two samples collected from Cheongdo. To examine this signal, two WClMV-specific primer sets (WClMV-1F/1R: CGTGCCGCTCTTGATAGAATC/CCTGGGATGTATTGGAAACCA [608 bp] and WClMV-2F/2R: CTGGTGACTCTGCTGCTCTT/TCGGAGCGACCATTAGTGATT [373 bp]) were designed based on the nt sequences of the LSON chip probes and ClYVV-specific primers used in Park et al. (2014). All samples were positive for WClMV and two samples were positive for ClYVV and WClMV in the RT-PCR analysis. To determine the complete genome of the three WClMV isolates, six primer sets were designed using the available nt sequences of previously reported WClMV isolates (AB056720, AB669182, X16636) downloaded from the NCBI database. Using these primer sets, RT-PCR, cloning, and sequencing were performed by SolGent Co., Ltd. (Daejeon, Korea). Consensus sequences were created after sequence assembly using DNAMAN ver. 7.0 (Lynnon Biosoft, Canada) and deposited in GenBank under accession nos. LC159488–90. Complete genomes of the three isolates were 5,843 nt long, and the 5′ and 3′-UTR regions were 107 and 53 nt long, respectively. Pairwise comparison of complete genome sequences showed 94.2 to 98.5% nt identities among themselves, and the three WClMV isolates shared 95 to 95.4% nt identity with WClMV RC isolates (AB669182). To confirm host range, sap was extracted from a single infected Suwon isolate and mechanically inoculated onto six species (G. max, Phaseolus angularis, P. vulgaris, Pisum sativum, Trifolium repens, and Vigna sinensis). At 3 to 4 days post inoculation (dpi), P. angularis, P. vulgaris, P. sativum, and V. sinensis showed local lesions on inoculated leaves. At 2 weeks post inoculation (wpi), P. angularis showed yellowing and mosaic symptoms and P. vulgaris, P. sativum, and V. sinensis developed mosaic symptoms on upper leaves. However, G. max and T. repens showed no symptoms on both inoculated and upper uninoculated leaves. At 6 wpi, leaves from all indicator plants were collected and tested using RT-PCR with WClMV-specific primers. RT-PCR yielded positive results for both inoculated and upper leaves in the five indicator plants; only G. max was found negative for WClMV. All RT-PCR amplicons were confirmed positive using direct sequencing. This is the first report of WClMV infection of white clover in Korea. Additionally, a new nationwide survey was performed in 2016 during which 40 white clover samples were collected from 12 regions. Of the 40 samples, 23 samples collected from 11 regions were positive for WClMV, implying that WClMV is widespread in Korea. The results suggest that WClMV should be removed from quarantine virus list in Korea.